VIRsiRNAdb

../../tmp/servers/virsirnadb/29203668
Result for your query siRNA sequence

RED	=100 % Complementary sequence
.	=Identical residue
blue alphabets	=mismatch
_	=Gap

Acc number	Strain name	Start	Alignment	End	% Identity
Query	virsi1163	1	`ggaactactgtcttcacgcag`	21
X61596.1	Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene	34	`.....................`	54	100
D10749.1	HPCHCJ1 Hepatitis C virus genomic RNA, complete genome, isolate: HC-J1	51	`.....................`	71	100
D13558.1	HPCJ483 Hepatitis C virus genome, complete sequence	51	`.....................`	71	100
D10750.1	HPCJ491 Hepatitis C virus genome, complete sequence	51	`.....................`	71	100
D10988.1	HPCJ8G Hepatitis C virus genome	51	`.....................`	71	100
D90208.1	HPCJCG Hepatitis C virus ORF gene, complete cds	39	`.....................`	59	100
D11168.1	HPCJTA Hepatitis C virus (HCV) complete genome	51	`.....................`	71	100
D11355.1	HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT'	51	`.....................`	71	100
D00944.1	HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds	50	`.....................`	70	100
M96362.1	HPCUNKCDS Hepatitis C virus mRNA, complete cds	52	`.....................`	72	100
M67463.1	HPCCGAA Hepatitis C virus subtype 1a, complete genome	51	`.....................`	71	100
L02836.1	HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome	40	`.....................`	60	100
M84754.1	HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome	51	`.....................`	71	100
M58335.1	HPCHUMR Hepatitis C virus subtype 1b, complete genome	42	`.....................`	62	100
M62321.1	HPCPLYPRE Hepatitis C virus subtype 1a, complete genome	51	`.....................`	71	100
S62220.1	Hepatitis C virus subtype 1b, complete genome	50	`.....................`	70	100
D14853.1	HPCCGS Hepatitis C virus (isolate HC-G9) genomic RNA, complete genome	51	`.....................`	71	100
D10934.1	HPCRNA Hepatitis C virus RNA, complete genome sequence	51	`.....................`	71	100
D30613.1	HPCPP Hepatitis C virus complete genome sequence	51	`.....................`	71	100
U16362.1	HCU16362 Hepatitis C virus subtype 1b, complete genome	52	`.....................`	72	100
D50482.1	HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g	39	`.....................`	59	100
D50483.1	HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g	39	`.....................`	59	100
D50484.1	HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g	39	`.....................`	59	100
D50485.1	HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g	39	`.....................`	59	100
D50481.1	HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g	39	`.....................`	59	100
D50480.1	HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g	39	`.....................`	59	100
D14484.1	HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome	51	`.....................`	71	100
U45476.1	HCU45476 Hepatitis C virus isolate HD-1, complete genome	51	`.....................`	71	100
D63822.1	HPCJK046E2 Hepatitis C virus (isolate JK046) genomic RNA, complete gen	48	`.....................`	68	100
D45172.1	HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd	51	`.....................`	71	100
D50409.1	Hepatitis C virus (isolate BEBE1) genomic RNA, complete genome	50	`.....................`	70	100
D85516.1	Hepatitis C virus genomic RNA, complete cds	51	`.....................`	71	100
AF011751.1	Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds	51	`.....................`	71	100
AF011752.1	Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds	51	`.....................`	71	100
U89019.1	HCU89019 Hepatitis C virus subtype 1b, complete genome	51	`.....................`	71	100
AJ000009.1	Hepatitis C virus complete genome sequence	34	`.....................`	54	100
D89815.1	Hepatitis C virus genomic RNA, complete sequence	51	`.....................`	71	100
AF054247.1	Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete	51	`.....................`	71	100
AF054248.1	Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete	51	`.....................`	71	100
AF054249.1	Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete	51	`.....................`	71	100
AF054250.1	Hepatitis C virus subtype 1b strain HC-J4, complete genome	41	`.....................`	61	100
AJ132996.1	Hepatitis C virus, complete genome, isolate HCV-AD78	50	`.....................`	70	100
AJ132997.1	Hepatitis C virus, complete genome, isolate HCV-AD78P1	50	`.....................`	70	100
AJ238799.1	Hepatitis C virus type 1b complete genome, isolate Con1	51	`.....................`	71	100
AF176573.1	Hepatitis C virus subtype 1b strain 274933RU, complete genome	51	`.....................`	71	100
AB016785.1	Hepatitis C virus genomic RNA, complete sequence	51	`.....................`	71	100
AF165045.1	Hepatitis C virus subtype 1b strain MD1-1, complete genome	39	`.....................`	59	100
AF165046.1	Hepatitis C virus subtype 1b strain MD1-2, complete genome	39	`.....................`	59	100
AF165049.1	Hepatitis C virus subtype 1b strain MD3-1, complete genome	39	`.....................`	59	100
AF165051.1	Hepatitis C virus subtype 1b strain MD4-1, complete genome	39	`.....................`	59	100
AF165052.1	Hepatitis C virus subtype 1b strain MD4-2, complete genome	39	`.....................`	59	100
AF165053.1	Hepatitis C virus subtype 1b strain MD5-1, complete genome	39	`.....................`	59	100
AF165054.1	Hepatitis C virus subtype 1b strain MD5-2, complete genome	39	`.....................`	59	100
AF165055.1	Hepatitis C virus subtype 1b strain MD6-1, complete genome	39	`.....................`	59	100
AF165056.1	Hepatitis C virus subtype 1b strain MD6-2, complete genome	39	`.....................`	59	100
AF165057.1	Hepatitis C virus subtype 1b strain MD7-1, complete genome	39	`.....................`	59	100
AF165058.1	Hepatitis C virus subtype 1b strain MD7-2, complete genome	39	`.....................`	59	100
AF165059.1	Hepatitis C virus subtype 1b strain MD8-1, complete genome	39	`.....................`	59	100
AF165060.1	Hepatitis C virus subtype 1b strain MD8-2, complete genome	39	`.....................`	59	100
AF165061.1	Hepatitis C virus subtype 1b strain MD9-1, complete genome	39	`.....................`	59	100
AF165062.1	Hepatitis C virus subtype 1b strain MD9-2, complete genome	39	`.....................`	59	100
AF165063.1	Hepatitis C virus subtype 1b strain MD10-1, complete genome	39	`.....................`	59	100
AF165064.1	Hepatitis C virus subtype 1b strain MD10-2, complete genome	39	`.....................`	59	100
AB031663.1	Hepatitis C virus (isolate VAT96) genomic RNA, complete genome	51	`.....................`	71	100
AF169002.1	Hepatitis C virus subtype 2a isolate NDM228, complete genome	50	`.....................`	70	100
AF169003.1	Hepatitis C virus subtype 2a isolate G2aK1, complete genome	50	`.....................`	70	100
AF169004.1	Hepatitis C virus subtype 2a isolate G2aK3, complete genome	50	`.....................`	70	100
AF169005.1	Hepatitis C virus subtype 2a isolate NDM59, complete genome	50	`.....................`	70	100
AF238481.1	Hepatitis C virus subtype 2a strain MD2a-1, complete genome	16	`.....................`	36	100
AF238482.1	Hepatitis C virus subtype 2a strain MD2a-2, complete genome	16	`.....................`	36	100
AF238483.1	Hepatitis C virus subtype 2a strain MD2a-4, complete genome	16	`.....................`	36	100
AF238484.1	Hepatitis C virus subtype 2a strain MD2a-5, complete genome	16	`.....................`	36	100
AF238485.1	Hepatitis C virus subtype 2a strain MD2a-7, complete genome	16	`.....................`	36	100
AF238486.1	Hepatitis C virus subtype 2b strain MD2b-1, complete genome	14	`.....................`	34	100
AF208024.1	Hepatitis C virus subtype 1b strain MD34, complete genome	39	`.....................`	59	100
AF207752.1	Hepatitis C virus subtype 1b strain MD11, complete genome	39	`.....................`	59	100
AF207753.1	Hepatitis C virus subtype 1b strain MD12, complete genome	39	`.....................`	59	100
AF207755.1	Hepatitis C virus subtype 1b strain MD14, complete genome	39	`.....................`	59	100
AF207756.1	Hepatitis C virus subtype 1b strain MD15, complete genome	39	`.....................`	59	100
AF207757.1	Hepatitis C virus subtype 1b strain MD16, complete genome	39	`.....................`	59	100
AF207758.1	Hepatitis C virus subtype 1b strain MD17, complete genome	39	`.....................`	59	100
AF207760.1	Hepatitis C virus subtype 1b strain MD19, complete genome	39	`.....................`	59	100
AF207761.1	Hepatitis C virus subtype 1b strain MD20, complete genome	39	`.....................`	59	100
AF207762.1	Hepatitis C virus subtype 1b strain MD21, complete genome	39	`.....................`	59	100
AF207763.1	Hepatitis C virus subtype 1b strain MD22, complete genome	39	`.....................`	59	100
AF207764.1	Hepatitis C virus subtype 1b strain MD23, complete genome	39	`.....................`	59	100
AF207765.1	Hepatitis C virus subtype 1b strain MD24, complete genome	39	`.....................`	59	100
AF207766.1	Hepatitis C virus subtype 1b strain MD25, complete genome	39	`.....................`	59	100
AF207767.1	Hepatitis C virus subtype 1b strain MD26, complete genome	39	`.....................`	59	100
AF207768.1	Hepatitis C virus subtype 1b strain MD27, complete genome	39	`.....................`	59	100
AF207769.1	Hepatitis C virus subtype 1b strain MD28, complete genome	39	`.....................`	59	100
AF207770.1	Hepatitis C virus subtype 1b strain MD29, complete genome	39	`.....................`	59	100
AF207771.1	Hepatitis C virus subtype 1b strain MD30, complete genome	39	`.....................`	59	100
AF207773.1	Hepatitis C virus subtype 1b strain MD32, complete genome	39	`.....................`	59	100
AF207774.1	Hepatitis C virus subtype 1b strain MD33, complete genome	39	`.....................`	59	100
AF271632.1	Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome	51	`.....................`	71	100
AB030907.1	Hepatitis C virus (isolate JPUT971017) genomic RNA, complete genome	51	`.....................`	71	100
AJ278830.1	Hepatitis C virus genomic RNA for polyprotein gene	51	`.....................`	71	100
AF290978.1	Hepatitis C virus subtype 1a isolate colonel, complete genome	39	`.....................`	59	100
AB049087.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT05	20	`.....................`	40	100
AB049088.1	Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094	51	`.....................`	71	100
AB049089.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10	20	`.....................`	40	100
AB049090.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14	20	`.....................`	40	100
AB049092.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14	20	`.....................`	40	100
AB049093.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15	20	`.....................`	40	100
AB049094.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16	52	`.....................`	72	100
AB049095.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16	20	`.....................`	40	100
AB049096.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19	20	`.....................`	40	100
AB049097.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19	20	`.....................`	40	100
AB049098.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20	20	`.....................`	40	100
AB049099.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21	51	`.....................`	71	100
AB049100.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21	20	`.....................`	40	100
AB049101.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22	20	`.....................`	40	100
AF333324.1	Hepatitis C virus type 1b polyprotein mRNA, complete cds	51	`.....................`	71	100
AB047639.1	Hepatitis C virus (isolate JFH-1) genomic RNA, complete genome	50	`.....................`	70	100
AB047640.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-1	50	`.....................`	70	100
AB047641.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-2	50	`.....................`	70	100
AB047642.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3	50	`.....................`	70	100
AB047642.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3	877	`..c..........._______`	890	61
AB047643.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-4	50	`.....................`	70	100
AB047644.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-5	50	`.....................`	70	100
AB047645.1	Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-6	50	`.....................`	70	100
AY051292.1	Hepatitis C virus (isolate India) polyprotein mRNA, complete cds	51	`.....................`	71	100
AF356827.1	Hepatitis C virus subtype 1b isolate HCV-S1, complete genome	51	`.....................`	71	100
AF356827.1	Hepatitis C virus subtype 1b isolate HCV-S1, complete genome	4310	`__............_______`	4321	57
AY045702.1	Hepatitis C virus isolate HCR6, complete genome	53	`.....................`	73	100
AF483269.1	Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom	16	`.....................`	36	100
AF511949.1	Hepatitis C virus isolate XF223 polyprotein-like gene, complete seque	51	`.....................`	71	100
AF511950.1	Hepatitis C virus isolate XF224 polyprotein-like gene, complete seque	23	`.....................`	43	100
AF139594.2	Hepatitis C virus subtype 1b strain HCV-N, complete genome	51	`.....................`	71	100
AB080299.1	Hepatitis C virus genomic RNA, complete genome, isolate:M1LE	51	`.....................`	71	100
AY232730.1	Hepatitis C virus clone MD2b1-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232731.1	Hepatitis C virus clone MD2b1-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232732.1	Hepatitis C virus clone MD2b2-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232733.1	Hepatitis C virus clone MD2b2-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232734.1	Hepatitis C virus clone MD2b3-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232735.1	Hepatitis C virus clone MD2b3-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232736.1	Hepatitis C virus clone MD2b4-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232737.1	Hepatitis C virus clone MD2b4-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232738.1	Hepatitis C virus clone MD2b5-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232739.1	Hepatitis C virus clone MD2b5-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232740.1	Hepatitis C virus clone MD2b6-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232741.1	Hepatitis C virus clone MD2b6-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232742.1	Hepatitis C virus clone MD2b7-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232743.1	Hepatitis C virus clone MD2b7-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232744.1	Hepatitis C virus clone MD2b8-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232745.1	Hepatitis C virus clone MD2b8-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232746.1	Hepatitis C virus clone MD2b9-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232747.1	Hepatitis C virus clone MD2b9-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232748.1	Hepatitis C virus clone MD2b10-1 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY232749.1	Hepatitis C virus clone MD2b10-2 polyprotein mRNA, complete cds	14	`.....................`	34	100
AY460204.1	Hepatitis C virus from Shanghai, complete genome	51	`.....................`	71	100
AY651061.1	Hepatitis C virus isolate Khaja1, complete genome	51	`.....................`	71	100
AY746460.1	Hepatitis C virus genotype 2a polyprotein gene, complete cds	50	`.....................`	70	100
AB154177.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154178.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154179.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154180.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154181.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154182.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154183.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154185.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154186.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154187.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154189.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154191.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154192.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154194.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154198.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154199.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154200.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154201.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154202.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154203.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154204.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154205.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AB154206.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.....................`	59	100
AY859526.1	Hepatitis C virus (isolate 6a33), complete genome	5	`.....................`	25	100
D84263.2	Hepatitis C virus (isolate VN235) genomic RNA, complete genome	48	`.....................`	68	100
D84264.2	Hepatitis C virus (isolate VN405) genomic RNA, complete genome	48	`.....................`	68	100
D84265.2	Hepatitis C virus (isolate VN004) genomic RNA, complete genome	48	`.....................`	68	100
AB191333.1	Hepatitis C virus genomic RNA, complete genome, strain:0	51	`.....................`	71	100
AY878650.1	Hepatitis C virus subtype 6k isolate KM45, complete genome	34	`.....................`	54	100
AY878651.1	Hepatitis C virus subtype 6k isolate KM41, complete genome	19	`.....................`	39	100
DQ071885.1	Hepatitis C virus subtype 1b polyprotein mRNA, complete cds	51	`.....................`	71	100
DQ155561.1	Hepatitis C virus (isolate D54) polyprotein gene, partial cds	23	`.....................`	43	100
DQ278891.1	Hepatitis C virus subtype 6k isolate KM45, complete genome	50	`.....................`	70	100
DQ278893.1	Hepatitis C virus subtype 6k isolate KM41, complete genome	51	`.....................`	71	100
DQ314805.1	Hepatitis C virus subtype 6e isolate GX004, complete genome	48	`.....................`	68	100
DQ314805.1	Hepatitis C virus subtype 6e isolate GX004, complete genome	2826	`___.t............a.__`	2841	66
AJ851228.1	Hepatitis C virus gene for polyprotein, genomic RNA, isolate Equatori	23	`.....................`	43	100
DQ278892.1	Hepatitis C virus isolate GZ52557, complete genome	48	`.....................`	68	100
DQ480512.1	Hepatitis C virus subtype 6a strain 6a77, complete genome	5	`.....................`	25	100
DQ480513.1	Hepatitis C virus subtype 6a strain 6a35, complete genome	5	`.....................`	25	100
DQ480514.1	Hepatitis C virus subtype 6a strain 6a63, complete genome	5	`.....................`	25	100
DQ480515.1	Hepatitis C virus subtype 6a strain 6a64, complete genome	5	`.....................`	25	100
DQ480516.1	Hepatitis C virus subtype 6a strain 6a61, complete genome	5	`.....................`	25	100
DQ480517.1	Hepatitis C virus subtype 6a strain 6a73, complete genome	5	`.....................`	25	100
DQ480518.1	Hepatitis C virus subtype 6a strain 6a65, complete genome	5	`.....................`	25	100
DQ480519.1	Hepatitis C virus subtype 6a strain 6a66, complete genome	5	`.....................`	25	100
DQ480520.1	Hepatitis C virus subtype 6a strain 6a67, complete genome	5	`.....................`	25	100
DQ480521.1	Hepatitis C virus subtype 6a strain 6a69, complete genome	5	`.....................`	25	100
DQ480522.1	Hepatitis C virus subtype 6a strain 6a72, complete genome	5	`.....................`	25	100
DQ480523.1	Hepatitis C virus subtype 6a strain 6a62, complete genome	5	`.....................`	25	100
DQ480524.1	Hepatitis C virus subtype 6a strain 6a74, complete genome	5	`.....................`	25	100
DQ835760.1	Hepatitis C virus subtype 6f isolate C-0044, complete genome	48	`.....................`	68	100
DQ835761.1	Hepatitis C virus subtype 6j isolate C-0667, complete genome	48	`.....................`	68	100
DQ835762.1	Hepatitis C virus subtype 6i isolate C-0159, complete genome	48	`.....................`	68	100
DQ835763.1	Hepatitis C virus subtype 6m isolate C-0208, complete genome	48	`.....................`	68	100
DQ835764.1	Hepatitis C virus subtype 6f isolate C-0046, complete genome	48	`.....................`	68	100
DQ835769.1	Hepatitis C virus subtype 6j isolate Th553, complete genome	48	`.....................`	68	100
DQ835769.1	Hepatitis C virus subtype 6j isolate Th553, complete genome	8003	`______.........c...._`	7990	61
DQ835770.1	Hepatitis C virus subtype 6i isolate Th602, complete genome	48	`.....................`	68	100
EF026073.1	Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds	28	`.....................`	48	100
EF032892.1	Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge	27	`.....................`	47	100
EF032893.1	Hepatitis C virus subtype 1b isolate BR1427_P3_11.10.03 polyprotein g	25	`.....................`	45	100
AB249644.1	Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima	51	`.....................`	71	100
AM408911.1	Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno	28	`.....................`	48	100
EF424626.1	Hepatitis C virus subtype 6p isolate QC216, complete genome	48	`.....................`	68	100
EF424627.1	Hepatitis C virus subtype 6o isolate QC227, complete genome	48	`.....................`	68	100
EF424628.1	Hepatitis C virus subtype 6l isolate 537796, complete genome	48	`.....................`	68	100
EF424629.1	Hepatitis C virus subtype 6c isolate Th846, complete genome	48	`.....................`	68	100
EF621489.1	Hepatitis C virus subtype 1a strain HC-TN, complete genome	51	`.....................`	71	100
EF638081.1	Hepatitis C virus subtype 1b from Hubei, complete genome	7	`.....................`	27	100
EF407415.1	Hepatitis C virus isolate 3018 polyprotein gene, complete cds	1	`.....................`	21	100
EF407417.1	Hepatitis C virus isolate 4040 polyprotein gene, complete cds	10	`.....................`	30	100
EF407419.1	Hepatitis C virus isolate 5003 polyprotein gene, complete cds	2	`.....................`	22	100
EF407432.1	Hepatitis C virus isolate 1013 polyprotein gene, complete cds	12	`.....................`	32	100
EF407433.1	Hepatitis C virus isolate 7046 polyprotein gene, complete cds	2	`.....................`	22	100
EF407437.1	Hepatitis C virus isolate 1030 polyprotein gene, complete cds	11	`.....................`	31	100
EF407441.1	Hepatitis C virus isolate 1036 polyprotein gene, complete cds	10	`.....................`	30	100
EF407443.1	Hepatitis C virus isolate 7024 polyprotein gene, complete cds	11	`.....................`	31	100
EF407447.1	Hepatitis C virus isolate 8004 polyprotein gene, complete cds	11	`.....................`	31	100
EF407448.1	Hepatitis C virus isolate 6018 polyprotein gene, partial cds	11	`.....................`	31	100
EF407449.1	Hepatitis C virus isolate 2027 polyprotein gene, complete cds	11	`.....................`	31	100
EF407455.1	Hepatitis C virus isolate 7065 polyprotein gene, complete cds	11	`.....................`	31	100
EF407456.1	Hepatitis C virus isolate 4025 polyprotein gene, complete cds	10	`.....................`	30	100
EF407460.1	Hepatitis C virus isolate 8007 polyprotein gene, complete cds	1	`.....................`	21	100
EF407461.1	Hepatitis C virus isolate 5004 polyprotein gene, complete cds	31	`.....................`	51	100
EF407470.1	Hepatitis C virus isolate 4064 polyprotein gene, complete cds	3	`.....................`	23	100
EF407483.1	Hepatitis C virus isolate 4043 polyprotein gene, complete cds	26	`.....................`	46	100
EF407485.1	Hepatitis C virus isolate 7026 polyprotein gene, complete cds	6	`.....................`	26	100
EF407501.1	Hepatitis C virus isolate 7055 polyprotein gene, complete cds	24	`.....................`	44	100
EF407502.1	Hepatitis C virus isolate 2038 polyprotein gene, complete cds	80	`.....................`	100	100
EF407502.1	Hepatitis C virus isolate 2038 polyprotein gene, complete cds	12	`..................___`	29	85
EF632069.1	Hepatitis C virus isolate TV241, complete genome	48	`.....................`	68	100
EF632070.1	Hepatitis C virus isolate TV249, complete genome	48	`.....................`	68	100
EF632071.1	Hepatitis C virus isolate VT21, complete genome	34	`.....................`	54	100
EU246930.1	Hepatitis C virus strain D9 polyprotein gene, complete cds	23	`.....................`	43	100
EU246933.1	Hepatitis C virus strain D33 polyprotein gene, complete cds	23	`.....................`	43	100
EU362876.1	Hepatitis C virus isolate 1013_FU24 polyprotein (pol) gene, complete	10	`.....................`	30	100
EU362879.1	Hepatitis C virus isolate 2005_FU24 polyprotein (pol) gene, partial c	10	`.....................`	30	100
EU362883.1	Hepatitis C virus isolate 4025_FU24 polyprotein (pol) gene, partial c	10	`.....................`	30	100
EU362884.1	Hepatitis C virus isolate 4035_FU24 polyprotein (pol) gene, complete	13	`.....................`	33	100
EU362890.1	Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c	10	`.....................`	30	100
EU362896.1	Hepatitis C virus isolate 7046_FU24 polyprotein (pol) gene, complete	10	`.....................`	30	100
EU362897.1	Hepatitis C virus isolate 7065_FU24 polyprotein (pol) gene, complete	10	`.....................`	30	100
EU362899.1	Hepatitis C virus isolate 1013q polyprotein (pol) gene, partial cds	12	`.....................`	32	100
EU362900.1	Hepatitis C virus isolate 1030q polyprotein (pol) gene, partial cds	11	`.....................`	31	100
EU362902.1	Hepatitis C virus isolate 2027q polyprotein (pol) gene, partial cds	11	`.....................`	31	100
EU362903.1	Hepatitis C virus isolate 4025q polyprotein (pol) gene, partial cds	10	`.....................`	30	100
EU363761.1	Recombinant Hepatitis C virus H77C/JFH1, complete genome	50	`.....................`	70	100
EU155330.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet	21	`.....................`	41	100
EU155374.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V308/2005, complet	20	`.....................`	40	100
AB426117.1	Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima	51	`.....................`	71	100
EU408326.1	Hepatitis C virus isolate 537798 polyprotein precursor, gene, complet	48	`.....................`	68	100
EU408326.1	Hepatitis C virus isolate 537798 polyprotein precursor, gene, complet	2826	`___.t............a.__`	2841	66
EU408327.1	Hepatitis C virus isolate 535318 polyprotein precursor, gene, complet	48	`.....................`	68	100
AB435162.2	Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima	51	`.....................`	71	100
AB429050.1	Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1	51	`.....................`	71	100
AM910652.2	Hepatitis C virus subtype 1g complete genome	23	`.....................`	43	100
EU158186.1	Hepatitis C virus isolate NK46, complete genome	17	`.....................`	37	100
EU857431.1	Hepatitis C virus subtype 1b isolate Whu, complete genome	51	`.....................`	71	100
EU798760.1	Hepatitis C virus subtype 6v isolate KMN-02 polyprotein precursor, ge	48	`.....................`	68	100
EU798761.1	Hepatitis C virus subtype 6v isolate KM046 polyprotein precursor, gen	17	`.....................`	37	100
AB442219.1	Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B-	51	`.....................`	71	100
AB442220.1	Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH	51	`.....................`	71	100
AB442221.1	Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH	51	`.....................`	71	100
AB442222.1	Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B-	51	`.....................`	71	100
FJ435090.1	Hepatitis C virus isolate KM181 genotype 6v, complete genome	48	`.....................`	68	100
FJ462431.1	Hepatitis C virus isolate QC139, complete genome	50	`.....................`	70	100
FJ462432.1	Hepatitis C virus isolate QC193, complete genome	50	`.....................`	70	100
FJ462433.1	Hepatitis C virus isolate QC249, complete genome	50	`.....................`	70	100
FJ462434.1	Hepatitis C virus isolate QC262, complete genome	50	`.....................`	70	100
FJ462435.1	Hepatitis C virus isolate QC264, complete genome	50	`.....................`	70	100
FJ462436.1	Hepatitis C virus isolate QC381, complete genome	50	`.....................`	70	100
FJ462437.1	Hepatitis C virus isolate QC382, complete genome	50	`.....................`	70	100
FJ462438.1	Hepatitis C virus isolate QC383, complete genome	50	`.....................`	70	100
FJ462439.1	Hepatitis C virus isolate QC384, complete genome	50	`.....................`	70	100
FJ462440.1	Hepatitis C virus isolate QC93, complete genome	50	`.....................`	70	100
FJ462441.1	Hepatitis C virus isolate QC97, complete genome	50	`.....................`	70	100
FJ839869.1	Hepatitis C virus isolate QC155, complete genome	50	`.....................`	70	100
FJ839870.1	Hepatitis C virus isolate QC274, complete genome	50	`.....................`	70	100
FN435993.1	Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN	51	`.....................`	71	100
AB520610.1	Hepatitis C virus subtype 1a genomic RNA, complete genome, strain: HC	51	`.....................`	71	100
FJ821465.1	Hepatitis C virus strain M21-2k/1b, complete genome	24	`.....................`	44	100
AB559564.1	Hepatitis C virus HCV gene for hepatitis C virus polyprotein, complet	51	`.....................`	71	100
GU133617.1	Hepatitis C virus subtype 1b, complete genome	51	`.....................`	71	100
FN666428.2	Hepatitis C virus gene for polyprotein, genomic RNA, subtype 2q, isol	23	`.....................`	43	100
D84262.2	Hepatitis C virus (isolate Th580) genomic RNA, complete genome GCCAGC	49	`.....................`	69	100
AF177036.1	Hepatitis C virus subtype 2a strain HC-J6CH clone pJ6CF, complete gen	50	`.....................`	70	100
AF009606.1	Hepatitis C virus subtype 1a polyprotein gene, complete cds	51	`.....................`	71	100
AF511948.1	Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque	51	`...................._`	70	95
EF407426.1	Hepatitis C virus isolate 8070 polyprotein genomic sequence	1	`_....................`	20	95
EF407504.1	Hepatitis C virus isolate 8069 polyprotein gene, complete cds	6	`_....................`	25	95
U01214.1	HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome	52	`.......t.............`	72	95
X76918.1	Hepatitis C virus genes for core, envelope and NS1 proteins	8	`...................g.`	28	95
AF011753.1	Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds	51	`.......t.............`	71	95
AF207754.1	Hepatitis C virus subtype 1b strain MD13, complete genome	39	`.......t.............`	59	95
AF207759.1	Hepatitis C virus subtype 1b strain MD18, complete genome	39	`..............a......`	59	95
AF207772.1	Hepatitis C virus subtype 1b strain MD31, complete genome	39	`.......t.............`	59	95
AB154190.1	Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola	39	`.t...................`	59	95
AY878652.1	Hepatitis C virus subtype 6n isolate KM42, complete genome	18	`.......a.............`	38	95
DQ278894.1	Hepatitis C virus subtype 6n isolate KM42, complete genome	52	`.......a.............`	72	95
DQ314806.1	Hepatitis C virus subtype 6g isolate HK6554, complete genome	48	`...g.................`	68	95
DQ835765.1	Hepatitis C virus subtype 6m isolate C-0185, complete genome	48	`.......a.............`	68	95
DQ835766.1	Hepatitis C virus subtype 6m isolate C-0192, complete genome	48	`.......a.............`	68	95
DQ835767.1	Hepatitis C virus subtype 6m isolate B4/92, complete genome	48	`.......a.............`	68	95
DQ835768.1	Hepatitis C virus subtype 6n isolate D86/93, complete genome	48	`.......a.............`	68	95
EF424625.1	Hepatitis C virus subtype 6q isolate QC99, complete genome	48	`.......t.............`	68	95
EF407493.1	Hepatitis C virus isolate 3031 polyprotein gene, complete cds	6	`....t................`	26	95
EU246939.1	Hepatitis C virus strain D49 polyprotein gene, complete cds	23	`.a...................`	43	95
EU362878.1	Hepatitis C virus isolate 1030_FU24 polyprotein (pol) gene, partial c	11	`.a...................`	31	95
AY587844.1	Hepatitis C virus strain N589 polyprotein gene, complete cds	1	`__...................`	19	90
EF407440.1	Hepatitis C virus isolate 7002 polyprotein gene, complete cds	1	`__...................`	19	90
EU362907.1	Hepatitis C virus isolate 7002q polyprotein (pol) gene, complete cds	1	`__...................`	19	90
EU239713.2	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V316/2001, complet	1	`__...................`	19	90
EU239714.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet	1	`__...................`	19	90
EU234061.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet	1	`__...................`	19	90
EU234062.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet	1	`__...................`	19	90
EU155217.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet	1	`__...................`	19	90
EU155218.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V145/2005, complet	1	`__...................`	19	90
EU155219.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet	1	`__...................`	19	90
EU155221.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet	1	`__...................`	19	90
EU155222.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet	1	`__...................`	19	90
EU155223.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet	1	`__...................`	19	90
EU155224.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet	1	`__...................`	19	90
EU155225.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet	1	`__...................`	19	90
EU155226.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet	1	`__...................`	19	90
EU155227.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V157/2003, complet	1	`__...................`	19	90
EU155228.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet	1	`__...................`	19	90
EU155229.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet	1	`__...................`	19	90
EU155230.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet	1	`__...................`	19	90
EU155231.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet	1	`__...................`	19	90
EU155232.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet	1	`__...................`	19	90
EU155234.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet	1	`__...................`	19	90
EU155235.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet	1	`__...................`	19	90
EU482833.1	Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet	1	`__...................`	19	90
EU482839.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet	1	`__...................`	19	90
EU482849.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet	1	`__...................`	19	90
EU482859.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet	1	`__...................`	19	90
EU482860.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet	1	`__...................`	19	90
EU482874.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet	1	`__...................`	19	90
EU482875.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet	1	`__...................`	19	90
EU482877.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet	1	`__...................`	19	90
EU482879.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet	1	`__...................`	19	90
EU482880.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet	1	`__...................`	19	90
EU482881.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet	1	`__...................`	19	90
EU482883.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V153/2005, complet	1	`__...................`	19	90
EU482885.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet	1	`__...................`	19	90
EU482886.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet	1	`__...................`	19	90
EU482888.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet	1	`__...................`	19	90
EU155253.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet	1	`__...................`	19	90
EU155254.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet	1	`__...................`	19	90
EU155255.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet	1	`__...................`	19	90
EU155256.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet	1	`__...................`	19	90
EU155257.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet	1	`__...................`	19	90
EU155258.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet	1	`__...................`	19	90
EU155259.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet	1	`__...................`	19	90
EU155260.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet	1	`__...................`	19	90
EU155262.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet	1	`__...................`	19	90
EU155263.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet	1	`__...................`	19	90
EU155279.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V441/2001, complet	1	`__...................`	19	90
EU155280.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet	1	`__...................`	19	90
EU155281.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet	1	`__...................`	19	90
EU155287.2	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V320/2001, complet	1	`__...................`	19	90
EU155301.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet	1	`__...................`	19	90
EU155302.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet	1	`__...................`	19	90
EU155303.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet	1	`__...................`	19	90
EU155305.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet	1	`__...................`	19	90
EU155306.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet	1	`__...................`	19	90
EU155307.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V353/2002, complet	1	`__...................`	19	90
EU155308.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V354/2003, complet	1	`__...................`	19	90
EU155315.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet	1	`__...................`	19	90
EU155316.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet	1	`__...................`	19	90
EU155317.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet	1	`__...................`	19	90
EU155318.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet	1	`__...................`	19	90
EU155324.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet	1	`__...................`	19	90
EU155325.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet	1	`__...................`	19	90
EU155326.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet	1	`__...................`	19	90
EU155328.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet	1	`__...................`	19	90
EU155329.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet	1	`__...................`	19	90
EU155331.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet	1	`__...................`	19	90
EU155332.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet	1	`__...................`	19	90
EU155334.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet	1	`__...................`	19	90
EU155335.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet	1	`__...................`	19	90
EU155336.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet	1	`__...................`	19	90
EU155337.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet	1	`__...................`	19	90
EU155356.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet	1	`__...................`	19	90
EU155357.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet	1	`__...................`	19	90
EU155358.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet	1	`__...................`	19	90
EU155359.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet	1	`__...................`	19	90
EU155360.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet	1	`__...................`	19	90
EU155361.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet	1	`__...................`	19	90
EU155362.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet	1	`__...................`	19	90
EU155363.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet	1	`__...................`	19	90
EU155364.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V288/2006, complet	1	`__...................`	19	90
EU155365.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet	1	`__...................`	19	90
EU155366.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet	1	`__...................`	19	90
EU155367.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V295/2002, complet	1	`__...................`	19	90
EU155368.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet	1	`__...................`	19	90
EU155369.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet	1	`__...................`	19	90
EU155370.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V300/2005, complet	1	`__...................`	19	90
EU155371.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V301/2005, complet	1	`__...................`	19	90
EU155372.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet	1	`__...................`	19	90
EU155373.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V307/2005, complet	1	`__...................`	19	90
EU155375.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V309/2006, complet	1	`__...................`	19	90
EU155376.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V311/2006, complet	1	`__...................`	19	90
EU155377.2	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V313/2006, complet	1	`__...................`	19	90
EU155381.2	Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V502/2004, complet	1	`__...................`	19	90
EU155382.2	Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V504/2003, complet	1	`__...................`	19	90
EU660384.1	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V55/2005, complete	1	`__...................`	19	90
EU660386.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet	1	`__...................`	19	90
EU660388.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet	1	`__...................`	19	90
EU255957.1	Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V260/2004, complet	1	`__...................`	19	90
EU255960.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet	1	`__...................`	19	90
EU256059.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V220/2005, complet	1	`__...................`	19	90
EU256061.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet	1	`__...................`	19	90
EU256062.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V368/2006, complet	1	`__...................`	19	90
EU256064.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet	1	`__...................`	19	90
EU256065.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet	1	`__...................`	19	90
EU256066.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V382/2003, complet	1	`__...................`	19	90
EU256088.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet	1	`__...................`	19	90
EU256089.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet	1	`__...................`	19	90
EU256090.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V162/2002, complet	1	`__...................`	19	90
EU256092.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet	1	`__...................`	19	90
EU256098.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet	1	`__...................`	19	90
EU256099.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V348/2002, complet	1	`__...................`	19	90
EU256100.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V349/2002, complet	1	`__...................`	19	90
EU256101.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V351/2002, complet	1	`__...................`	19	90
EU256102.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet	1	`__...................`	19	90
EU256103.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V418/2001, complet	1	`__...................`	19	90
EU256105.1	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V505/2001, complet	1	`__...................`	19	90
EU256000.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet	1	`__...................`	19	90
EU256001.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet	1	`__...................`	19	90
EU256045.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V380/2003, complet	1	`__...................`	19	90
EU256054.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V443/2001, complet	1	`__...................`	19	90
EU256075.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet	1	`__...................`	19	90
EU256076.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V280/2004, complet	1	`__...................`	19	90
EU256077.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V283/2005, complet	1	`__...................`	19	90
EU256078.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V284/2005, complet	1	`__...................`	19	90
EU256079.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V286/2005, complet	1	`__...................`	19	90
EU256080.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V292/2002, complet	1	`__...................`	19	90
EU256081.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet	1	`__...................`	19	90
EU256082.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet	1	`__...................`	19	90
EU256083.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet	1	`__...................`	19	90
EU256084.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet	1	`__...................`	19	90
EU256085.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V305/2003, complet	1	`__...................`	19	90
EU255961.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet	1	`__...................`	19	90
FJ024086.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1704/2007, comple	1	`__...................`	19	90
FJ024277.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple	1	`__...................`	19	90
FJ024279.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple	1	`__...................`	19	90
EU862835.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial	1	`__...................`	19	90
FJ205867.1	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1709/2007, comple	1	`__...................`	19	90
FJ390396.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple	1	`__...................`	19	90
FJ390397.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple	1	`__...................`	19	90
FJ390398.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple	1	`__...................`	19	90
FJ478453.1	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple	1	`__...................`	19	90
EU862837.1	Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet	1	`__...................`	19	90
EF407413.1	Hepatitis C virus isolate 5012 polyprotein gene, complete cds	1	`___..................`	18	85
EF407427.1	Hepatitis C virus isolate 6025 polyprotein gene, complete cds	1	`___..................`	18	85
EF407438.1	Hepatitis C virus isolate 7012 polyprotein gene, complete cds	1	`___..................`	18	85
EF407453.1	Hepatitis C virus isolate 4035 polyprotein gene, complete cds	1	`___..................`	18	85
EU362881.1	Hepatitis C virus isolate 2027_FU24 polyprotein (pol) gene, partial c	14	`___..................`	31	85
D28917.1	HPCK3A Hepatitis C virus (isolate HCV-K3a/650) genomic RNA, complete g	49	`......t............g.`	69	90
D49374.1	HPCFG Hepatitis C virus (isolate Tr Kj) genomic RNA, complete genome	49	`......t............g.`	69	90
D63821.1	HPCJK049E1 Hepatitis C virus (isolate JK049) genomic RNA, complete gen	49	`......t............g.`	69	90
AF046866.1	Hepatitis C virus subtype 3a strain CB polyprotein gene, complete cds	49	`......t............g.`	69	90
AF165047.1	Hepatitis C virus subtype 1b strain MD2-1, complete genome	39	`....t.........a......`	59	90
AF165048.1	Hepatitis C virus subtype 1b strain MD2-2, complete genome	39	`....t.........a......`	59	90
FJ407092.1	Hepatitis C virus isolate IND-HCV-3i, complete genome	49	`......t............g.`	69	90
GQ275355.1	Hepatitis C virus subtype 3a, complete genome	49	`......t............g.`	69	90
D17763.1	HPCEGS Hepatitis C virus (isolate NZL1) genomic RNA, complete genome	49	`......t............g.`	69	90
EU155261.2	Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet	1	`__....c..............`	19	85
EF407423.1	Hepatitis C virus isolate 8028 polyprotein gene, complete cds	1	`____.................`	17	80
EF407487.1	Hepatitis C virus isolate 6057 polyprotein gene, complete cds	1	`___.t................`	18	80
EF407503.1	Hepatitis C virus isolate 5083 polyprotein gene, complete cds	1	`___.t................`	18	80
EF407439.1	Hepatitis C virus isolate 8003 polyprotein gene, complete cds	1	`_____................`	16	76
EF407465.1	Hepatitis C virus isolate 6017 polyprotein gene, complete cds	1	`_____................`	16	76
EF407471.1	Hepatitis C virus isolate 5044 polyprotein gene, complete cds	1	`_____................`	16	76
EF407472.1	Hepatitis C virus isolate 4034 polyprotein gene, complete cds	2	`_____................`	17	76
EF407479.1	Hepatitis C virus isolate 4036 polyprotein gene, complete cds	1	`_____................`	16	76
EU362892.1	Hepatitis C virus isolate 7012_FU24 polyprotein (pol) gene, complete	1	`_____................`	16	76
EF407418.1	Hepatitis C virus isolate 7020 polyprotein gene, complete cds	1	`______...............`	15	71
EF407469.1	Hepatitis C virus isolate 4014 polyprotein gene, complete cds	1	`______...............`	15	71
EF407488.1	Hepatitis C virus isolate 8016 polyprotein gene, complete cds	1	`______...............`	15	71
EF407497.1	Hepatitis C virus isolate 5002 polyprotein gene, complete cds	1	`______...............`	15	71
EU155244.2	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V90/2005, complete	1	`________.............`	13	61
EU482870.1	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V75/2004, complete	1	`________.............`	13	61
EU256002.1	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V41/2006, complete	1	`________.............`	13	61
EU862840.1	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V40/2003, complete	1	`________.............`	13	61
EU155248.2	Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V336/2006, complet	1457	`___...gg.c...........`	1474	71

VIRsiRNAdb

Database of Viral siRNA / shRNA